View Full Table | Close Full ViewTable 1.

List of Rf8 mapping primers.

 
Marker Located in gene Marker type Primer sequence (5′-3′) Restriction enzyme Tm
76755p2 GRMZM2G527387 Codominant TGAAGAAATGGTGATGCGAGC / ACAGATGGCACTCCTGATGTGTC 56
135087p1 GRMZM2G135087 Size polymorphism TGGAATACTTGCTTCTTGCTTGG / CAATGGTTATGCGTGAACGGG 56
144635p4 GRMZM2G144635 Codominant TTGTGCTTGGGCTTTTCACG / CCTGACTTCCTGCTTTTGTATCGC 54
66902p1 GRMZM2G066902 Codominant CGCTAACGCTTTCCTCTTGGAC / CTGTTCCCCATCCTTTCTACATC 56
csu811_p9 AC217293.3_FGT007 Codominant CGAGGTCGAATCAAATTCTTCC / GTACGGGCGGTTAAAGAAAC 56
J04p6 GRMZM2G108171 Size polymorphism CAAAGTCTCTGTCACTGTCACCTGG / TCTTCTTCCTCCTCCCTTGGAC 60
J04p8 GRMZM2G108171 Size polymorphism TTAGTTGATTAGAGGAGGTTGCGG / GTCATTTAGCGTTTAGCGTCCAAG 60
18p4 GRMZM2G092284 CAPS marker AAGATCATTCGGCGCGAGAA / CGGAGCCAAAACATGTGAAA MseI 56
87p2 GRMZM2G035807 CAPS marker ACATTGGTCTTTGTGGAGAC / TTCACACCCAACAGGTTGAC DraI 56
10p2 GRMZM2G149935 CAPS marker CGTAATGAAATGCGACGACG / CGTAGCCAGGTCCATTAGCA MseI 56
26p3 GRMZM2G147819 CAPS marker AGTTAAGGCTATCAGAATGA / ACTGACGATCAAATCTGATC ApoI 56
umc36_p10 GRMZM2G059033 Codominant CCTGGTGCACCATGTGATAGTTT / TTACCATGCCAATGGAATTG 56
Marker names are based on the predicted gene they are designed from on MaizeSequence release 5b.60 (Ware et al., 2011; Schnable et al., 2009).
Genes are from the filtered gene set from MaizeSequence release 5b.60 (Ware et al., 2011).
§Tm, melting temperature.
CAPS, cleaved amplified polymorphic sequence.



View Full Table | Close Full ViewTable 2.

Comparison of genetic and physical distances among polymerase chain reaction (PCR) markers flanking the rf8 locus.

 
Interval Number of plants tested Confirmed informative recombinants Maximum no. recombinants Genetic distance B73 physical size kbp:cM ratio
76755p2 to 135087p1 616 31 71 8.25 ± 3.25 4.55 Mbp 552
76755p2 to Rf8 607 28 66 7.14 ± 3.13
Rf8 to 135087p1 702 2 50 3.70 ± 3.42
135087p1 to 144635p4 701 1 54 3.92 ± 3.78 0.81 Mbp 207
144635p4 to 66902p1 700 22 75 6.93 ± 3.79 1.99 Mbp 287
66902p1 to csu811_p9 1141 22 30 2.28 ± 0.35 0.85 Mbp 371
csu811_p9 to umc36_p10 1106 40 43 3.75 ± 0.14 1.00 Mbp 268
Genetic distances are averages of the minimum and maximum amount of recombination possible for a given region. The minimum was calculated based on confirmed informative recombinants. The maximum reflects unresolved but possible crossover locations.
Corresponding B73 physical size taken from MaizeSequence release 5b.60 (Ware et al., 2011; Schnable et al., 2009).



View Full Table | Close Full ViewTable 3.

Annotated genes in the rf8 flanking region.

 
Gene Predicted function Sequence coordinates
GRMZM2G527387 Unknown and/or sodium symporter 223,510,475–223,522,044
GRMZM2G130379 Unknown and/or GPCR 223,587,853–223,589,462
GRMZM2G410567 GH3 auxin-responsive promoter 223,632,037–223,638,458
GRMZM2G322844 Natural resistance-associated macrophage protein 223,721,037–223,727,516
GRMZM2G027001 Unknown 223,777,974–223,778,971
GRMZM2G027130 Chalcone synthase 223,791,790–223,793,218
GRMZM2G056088 Unknown 223,795,555–223,799,946
GRMZM2G151336 Unknown 223,869,955–223,872,859
GRMZM2G151227 whp1 Thiolase and/or chalcone synthase 223,888,706–223,892,691
GRMZM2G003043 Cyclin-like 223,975,596–223,982,847
GRMZM5G891855 Unknown 224,015,038–224,047,387
GRMZM2G166776 Unknown and/or antifreeze 224,064,456–224,065,350
GRMZM2G166718 Unknown and/or antifreeze 224,106,079–224,107,632
GRMZM2G166674 Unknown 224,135,400–224,136,784
GRMZM5G862594 Unknown 224,138,778–224,140,145
GRMZM2G166661 Unknown 224,145,708–224,147,676
GRMZM2G173377 Unknown 224,174,093–224,175,094
GRMZM2G065144 Ferric reductase 224,236,806–224,242,062
GRMZM2G169095 Peptidase M24 224,332,394–224,344,331
GRMZM2G358619 Ferric reductase 224,384,678–224,390,935
GRMZM2G358633 Unknown 224,412,145–224,414,871
GRMZM2G037993 Ferric reductase 224,463,082–224,467,568
GRMZM2G038024 Unknown 224,468,664–224,469,629
GRMZM2G414114 TCP transcription factor 224,523,636–224,527,847
GRMZM2G114948 Unknown and/or DUF247 224,536,161–224,537,608
GRMZM2G023328 Tropomyosin 224,546,497–224,547,584
GRMZM2G023585 Unknown 224,552,623–224,554,444
GRMZM2G105317 Histone fold 224,591,447–224,595,385
GRMZM2G097034 Unknown 224,624,457–224,624,678
GRMZM2G455945 Unknown 224,659,107–224,672,723
GRMZM2G703399 Unknown 224,699,998–224,700,520
GRMZM2G097896 Patatin and/or storage protein 224,734,195–224,741,296
GRMZM2G064475 Unknown 224,807,457–224,820,942
GRMZM2G064366 Unknown 224,831,235–224,839,536
GRMZM2G089625 Unknown 224,847,792–224,848,164
GRMZM2G301399 Unknown 224,851,546–224,852,841
GRMZM2G408768 14-3-3 protein binding domain 224,904,656–224,907,978
GRMZM2G107945 Galactose oxidase-like 224,908,574–224,912,937
GRMZM2G107931 Unknown 224,914,975–224,915,737
GRMZM2G107922 Unknown 224,931,792–224,932,515
GRMZM5G812796 Unknown 224,947,849–224,948,433
GRMZM2G367348 CAP 224,982,658–224,983,164
GRMZM2G066546 Unknown 224,988,216–224,988,793
GRMZM2G082799 Unknown 224,992,866–224,993,391
GRMZM2G082785 Unknown 224,995,417–224,996,267
GRMZM2G057056 MAF and/or putative inhibitor of septum formation 225,019,032–225,020,646
GRMZM2G355940 Peptide chain release factors 225,023,880–225,033,407
GRMZM2G056977 Unknown 225,036,504–225,037,190
GRMZM5G838671 Unknown and/or zinc finger domain 225,094,961–225,096,904
GRMZM2G090559 Unknown and/or ankyrin repeat 225,097,180–225,128,205
GRMZM2G099765 Peptidase C1A 225,156,707–225,158,802
GRMZM2G099862 Unknown and/or DNA binding 225,159,420–225,162,831
GRMZM2G022863 Knottin 225,173,505–225,174,128
GRMZM2G074496 Unknown and/or defense 225,227,431–225,230,275
GRMZM2G074664 NUDIX hydrolase 225,231,579–225,233,724
GRMZM2G460429 Unknown 225,260,736–225,266,407
GRMZM2G139813 Aminotransferase 225,299,360–225,307,593
GRMZM2G448692 Unknown and/or DUF724 225,318,983–225,321,945
GRMZM2G040932 Knottin 225,324,513–225,325,121
GRMZM2G024641 AT hook-like and/or Tudor-like 225,364,989–225,366,192
GRMZM2G426158 Unknown 225,408,728–225,409,852
GRMZM2G055594 Unknown 225,444,080–225,444,896
GRMZM2G055621 Unknown 225,444,309–225,444,896
GRMZM2G355760 Unknown 225,449,048–225,451,754
GRMZM2G458075 Protein kinase-like 225,525,987–225,532,287
GRMZM2G068011 Unknown 225,537,200–225,538,437
GRMZM2G405804 Unknown 225,612,135–225,619,263
GRMZM2G159756 Protein kinase-like 225,647,692–225,652,047
GRMZM2G170161 BSD domain 225,677,900–225,682,490
GRMZM2G470984 Phytosulfokine 225,678,026–225,678,382
GRMZM2G001405 Decarboxylase 225,703,852–225,705,177
GRMZM2G070831 Pre-mRNA processing 225,766,169–225,769,071
GRMZM2G372058 Unknown and/or leucine rich repeat 225,781,716–225,784,625
GRMZM2G372068 UDP glycosyltransferases 225,806,982–225,808,719
GRMZM2G331417 ATP synthase 225,822,494–225,823,126
GRMZM2G577201 Unknown 225,823,425–225,824,871
GRMZM2G007028 Unknown and/or AT hook-like 225,825,290–225,833,496
GRMZM2G135354 Prefoldin 225,851,426–225,853,770
GRMZM2G135314 Unknown 225,854,099–225,855,733
GRMZM2G433731 Unknown 225,857,203–225,861,698
GRMZM2G314940 Unknown 225,937,816–225,938,878
GRMZM2G355185 Unknown 226,017,163–226,020,660
GRMZM2G703402 Unknown 226,024,413–226,025,404
GRMZM2G067713 Unknown 226,050,306–226,052,861
GRMZM2G313110 Unknown 226,178,170–226,179,367
GRMZM2G023652 Unknown and/or Xklp2-like 226,201,724–226,206,198
GRMZM2G457381 DNA binding 226,314,027–226,323,829
GRMZM2G106531 Carotene isomerase 226,366,352–226,371,341
GRMZM2G106604 Unknown and/or DUF593 226,373,905–226,378,075
GRMZM2G106655 Cytochrome P450 226,392,734–226,394,830
GRMZM2G451729 Unknown 226,410,242–226,413,026
GRMZM2G150813 Unknown and/or zinc finger CCHC domain 226,422,679–226,426,851
GRMZM2G083095 Chaperone and/or tailless complex polypeptide 226,447,069–226,451,914
GRMZM2G083599 Glycoside hydrolase 226,452,553–226,454,581
GRMZM5G848516 Unknown 226,557,104–226,557,487
GRMZM2G066394 Pseudouridine synthase 226,585,530–226,586,233
GRMZM2G008854 Kinase-like 227,652,480–227,654,480
GRMZM2G345622 Peptidase S8 226,630,196–226,633,901
GRMZM2G053384 Pentatricopeptide repeat protein 226,676,462–226,678,841
GRMZM2G353343 Unknown 226,679,089–226,680,887
GRMZM2G552706 Unknown 226,690,744–226,691,773
GRMZM2G000936 Tetratricopeptide repeat and/or protein binding 226,699,977–226,705,433
GRMZM2G053713 Protein phosphatase 2C-like 226,963,057–227,123,377
GRMZM2G318412 Unknown and/or homeodomain-like 227,029,696–227,031,991
GRMZM2G450166 Pentatricopeptide repeat protein 227,045,894–227,046,871
AC196106.2_FG001 Unknown and/or C terminal domain of Paramyxovirinae RNA polymerase 227,173,374–227,175,299
GRMZM2G165173 Pentatricopeptide repeat protein 227,209,438–227,212,064
GRMZM2G165216 Unknown and/or kinase-like 227,213,495–227,214,494
GRMZM2G303463 Unknown and/or HLH DNA binding domain 227,264,500–227,268,560
GRMZM2G004521 Kelch motif and/or pentatricopeptide repeat 227,277,639–227,282,413
GRMZM2G303474 Unknown 227,285,977–227,286,612
GRMZM2G081377 Unknown 227,303,145–227,304,513
GRMZM2G552793 Unknown 227,400,943–227,401,440
GRMZM2G145930 Unknown and/or kinase-like 227,516,080–227,537,665
GRMZM2G145916 Unknown 227,539,458–227,539,875
GRMZM2G158308 Pentatricopeptide repeat protein 227,540,645–227,542,487
GRMZM5G857814 Unknown 227,542,645–227,543,218
GRMZM2G158298 Histone H2A 227,544,895–227,545,712
GRMZM2G158288 Nucleic acid-binding proteins and/or OB fold 227,546,551–227,551,614
GRMZM2G158279 Unknown 227,552,200–227,552,975
GRMZM5G847407 Unknown 227,553,873–227,554,031
GRMZM2G458122 Pentatricopeptide repeat-like 227,586,065–227,587,703
GRMZM2G158175 Unknown 227,594,474–227,598,371
GRMZM2G439814 Pentatricopeptide repeat protein 227,599,623–227,600,372
AC215723.3_FG001 Pentatricopeptide repeat protein 227,600,700–227,601,599
GRMZM2G453956 Pentatricopeptide repeat protein 227,604,054–227,608,803
GRMZM2G408216 Unknown and/or peptidase 227,610,560–227,618,077
GRMZM2G108482 Pentatricopeptide repeat-like 227,618,518–227,619,348
GRMZM2G008854 Kinase-like 227,652,480–227,654,480
GRMZM2G104286 Pentatricopeptide repeat protein 227,663,963–227,665,778
GRMZM2G008865 Histone H2A 227,657,388–227,658,767
GRMZM2G116395 Unknown 227,859,648–227,861,492
GRMZM2G416498 Pentatricopeptide repeat protein 227,876,866–227,880,456
GRMZM2G116461 Unknown 227,882,663–227,886,563
GRMZM2G416518 Pentatricopeptide repeat-like 227,893,366–227,895,004
GRMZM2G416541 Unknown 227,929,684–227,931,623
GRMZM2G416544 Histone H2A 227,932,245–227,946,984
GRMZM2G124555 Kinase 227,955,470–227,957,312
GRMZM2G124602 Pentatricopeptide repeat protein 227,958,844–227,962,673
GRMZM2G124616 Unknown and/or peptidase-like 227,964,374–227,971,891
GRMZM2G097511 Histone H2A 228,003,621–228,005,314
GRMZM2G135195 Glycotransferase 228,034,704–228,036,176
GRMZM2G436001 MiaB methiolase 228,040,126–228,050,456
GRMZM2G436001 Methylthiotransferase 228,046,347–228,050,468
GRMZM2G435993 Unknown 228,054,663–228,062,838
GRMZM2G135087 Unknown and/or DUF295 domain 228,064,519–228,066,636
Genes taken from the filtered gene set and coordinates are from MaizeSequence release 5b.60 (Ware et al., 2011; Schnable et al., 2009).
ATP, adenosine triphosphate; mRNA, messenger RNA.
§Sequence coordinates corresponding to MaizeSequence release 5b.60 (Ware et al., 2011; Schnable et al. 2009).
These genes contain the flanking markers for Rf8. Gene GRMZM2G76755 contains the proximal flanking marker while gene GRMZM2G135087 contains the distal flanking marker.
#Genes of particular interest including the 10 predicted pentatricopeptide repeat (PPR)-encoding genes, PPR repeat-like containing genes, a tetratricopeptide repeat (TPR) encoding gene, and an RNA editing gene.



View Full Table | Close Full ViewTable 4.

Chi-square test of the expected and observed outcome of linkage test of Rf8 and Rf*.

 
T-st308
CD1721
Number of progeny accumulating Rf8- and/or Rf*-mediated T-urf13 transcripts
Number of progeny accumulating Rf8- or Rf*-mediated T-urf13 transcripts
Assumptions Rf8 or Rf* rf8 or rf* χ2 Rf8 Rf* χ2
Independent Expected (3:1) 39.7 13.3 17.6 Expected (1:1) 26.5 26.5 0.17
Allelic Expected (1:0) 53 0 0 Expected (1:1) 26.5 26.5 0.17
Observed 53 0 Observed 25 28
Under the assumption of independence, probe T-st308 would detect a 3:1 segregation for the presence of Rf8- and/or Rf*-mediated T-urf13 transcripts (Rf8-8703, Rf*-7212/rf8-W64A, rf*-W64A; Rf8–8703, rf*-W64A/rf8-W64A, rf*-W64A; and rf8-W64A, Rf*-7212/rf8-W64A, rf*-W64A) to the absence of Rf8- and/or Rf*-mediated T-urf13 transcripts (rf8-W64A, rf*-W64A/rf8-W64A, rf*-W64A). Probe CD1721 would detect a 1:1 segregation for the presence of Rf8-mediated T-urf13 transcripts and the presence of Rf*-mediated T-urf13 transcripts (Rf8-8703/rf-W64A or Rf*-7212/rf-W64A). Under the assumption of close linkage or allelism, probe T-st308 would detect presence Rf8- or Rf*-mediated T-urf13 transcripts to the inability to detect the Rf*-mediated T-urf13 transcripts.
Indicates these individuals do not accumulate any restorer of fertility (Rf)-mediated novel T-urf13 transcripts.
§Indicates these individuals accumulate the Rf*-mediated T-urf13 transcripts but cannot be detected by CD1721 probe.



View Full Table | Close Full ViewTable 5.

Fertility summary of the 1997 and 2008 rf8 mapping population.

 
Progenitor fertility phenotype Number of plants with the indicated phenotypes
Progenitor Progeny rows S “S” Total no. of plants
95 3233-2 “S” 97 2219–97 2226 118 44 166
97 2220-11 “S” 08 7243–08 7247 167 14 183
97 2220-12 “S” 08 7248–08 7250 and 08 7301–08 7302 179 14 194
97 2220-17 S 08 7303–08 7307 117 7 125
97 2220-22 “S” 08 7308–08 7312 147 14 161
97 2221-3 S 08 7313–08 7316 129 32 163
97 2222-15 “S” 08 7327–08 7331 163 25 188
97 2222-3 S 08 7322–08 7326 162 12 174
97 2223-15 “S” 08 7332–08 7336 175 4 179
97 2224-3 “S” 08 7337–08 7341 164 12 176
97 2225-1 S 08 7342–08 7346 172 17 189
2008 Total: 1575 151 1731
Progenitor plants are (Texas [T]) Rf8-8703/rf8-W64A crossed by (normal [N]) rf8-W64A/rf8-W64A. The genotype of all the progenitors was inferred by presence of the 1.42- and 0.42-kbp T-urf13 transcripts.
S, sterile; “S,” partially fertile.



View Full Table | Close Full ViewTable 6.

Segregation of the 1.42- and 0.42-kbp T-urf13 transcripts and partial male fertility.

 
T-urf13 transcript accumulation Number of partially male fertile plants Number of male sterile plants Total
1.42 and 0.42 kbp present 27 88 115
1.42 and 0.42 kbp absent 17 48 65
Total 44 136 180
Plants are a subset of the 2008 mapping population. Plants were chosen for RNA blot analysis based on prior knowledge of their genotype scores and fertility phenotype.



View Full Table | Close Full ViewTable 7.

Genotypic segregation of polymerase chain reaction (PCR) marker 66902p1 in the Rf8 population.

 
Number of plants with the indicated 66902p1 score
Progenitor Progeny rows Heterozygous Recessive χ21:1 p value
97 2220-11 08 7243–08 7247 60 67 0.386 0.535
97 2220-12 08 7248–08 7250 and 08 7301–08 7302 33 41 0.865 0.352
97 2220-17 08 7303–08 7307 37 42 0.316 0.574
97 2220-22 08 7308–08 7312 0 121 121.000 0.000
97 2221-3 08 7313–08 7316 34 47 2.086 0.149
97 2222-15 08 7327–08 7331 54 71 2.312 0.128
97 2222-3 08 7322–08 7326 82 67 1.510 0.219
97 2223-15 08 7332–08 7336 61 67 0.281 0.596
97 2224-3 08 7337–08 7341 57 76 2.714 0.099
97 2225-1 08 7342–08 7346 43 51 0.681 0.409
Adjusted total 461 529 4.671 0.792
All progenitor plants were crossed by (normal [N]) W64A to derive the 2008 plants.
Progeny did not segregate for marker 66902p1; however, 76755p2 segregated 47 homozygous to 28 heterozygous; p value = 0.028. This can be explained by a crossover event happing between 144635p4 and 66902p1 during meiosis in plant 97 2220-22.
§Total reported is excluding progeny of 97 2220-22, which did not segregate for 66902p1. Eight degrees of freedom were used to calculate the adjusted total p value.



View Full Table | Close Full ViewTable 8.

Phenotypic ratios associated with various amounts of backcrossing.

 
Parental genotype Pollen donor Parental fertility phenotype Parental transcript accumulation 2009 progeny rows Number of plants with the indicated phenotypes
Total no. of plants
Cross S “S” “F”
08 7330-1 × 7319 BC4 (N) W64A S 1.42 and 0.42 present 8132, 8136, 8147, and 8148 53 1 0 54
01 4136-4 × 4018 BC6TC1 (N) W64A “S” 1.42 and 0.42 present 8123, 8126, 8130, and 8145 23 20 11 54
02 5230-21 × 5229-3 BC6TC2 (N) wx1-m8 “S” 1.42 and 0.42 present 8131, 8141, 8146, and 8150 8 18 22 48
00 3437-1 × 3446 BC5TC1 (N) wx1-m8 NA 1.42 and 0.42 present 8124, 8133, 8140, and 8142 7 23 17 47
01 4136-3 × 4149 BC5TC2 (N) wx1-m8 “S” 1.42 and 0.42 present 8135, 8137, 8139, and 8144 13 20 2 35
Crosses are diagrammed in Fig. 1 and were planted in 2009.
N, normal. Pollen donor lines, which correspond to the second plant number in the Cross column, are listed.
§S, sterile; “S,” partially fertile; “F,” mostly fertile.
Parental fertility phenotype not available (NA).



View Full Table | Close Full ViewTable 9.

Average days after planting to the first flowering (DAPFF) in partially male-fertile and mostly male-fertile plants.

 
Genotype Phenotype Average DAPFF p value
BC5TC1 Mostly fertile 63.9 0.0014**
Partially fertile 67.3
BC5TC2 Mostly fertile 67.5 0.0092**
Partially fertile 70.0
BC6TC1 Mostly fertile 66.5 0.0030**
Partially fertile 68.9
BC6TC2 Mostly fertile 65.4 0.0113**
Partially fertile 68.1
**Significant at the 0.01 probability level.
Mostly male-fertile plants flowered significantly earlier than partially male-fertile plants of a given genotype.



View Full Table | Close Full ViewTable 10.

Comparisons of species and their fertility restorer genes.

 
Cytoplasm Mode of restoration Restorer genes Gene location Reference
Oryza sativa L. (rice) WA Sporophytic OsRf4 10L Yao et al., 1997
DA Sporophytic Osq-Rf-10-2 10L Xie et al., 2002
BT Gametophytic OsRf1a, OsRf1b 10L Akagi et al., 2004; Komori et al., 2004; Wang et al., 2006
HL Gametophytic OsRf5, OsRf6 10L Liu et al., 2004
Zea mays L. (maize) T Sporophytic ZmRf1 3 Schnable and Wise, 1994
ZmRf2 9S Schnable and Wise, 1994
ZmRf8, ZmRf* 2L Pei, 2000
S Gametophytic ZmRf3 2L Kamps and Chase, 1997; Xu et al., 2009
Gossypium hirsutum L. (cotton) D2 Sporophytic GhRf1 D5 Meyer, 1975; Wang et al., 2007; Wang et al., 2009;
D8 Gametophytic GhRf2 D5 Zhang and Stewart, 2001
Sorghum bicolor (L.) Moench (sorghum) A1 Sporophytic SbRf1 SBI-08L Klein et al., 2005
SbRf2 SBI-02 Jordan et al., 2010
SbRf5 SBI-05 Jordan et al., 2011
Brassica napus L. (canola) Ogura Sporophytic BnRfo CN19 Brown et al., 2003; Feng et al., 2009
Petunia ×atkinsiana (Sweet) D. Don ex W. H. Baxter (petunia) RM Gametophytic Phrf-PPR592 4 Bentolila et al., 2002; Bentolila et al., 1998
Phaseolus vulgaris L. (bean) Sprite NA PvFr, PvFr2 K He et al., 1995; Jia et al., 1997
Helianthus annuus L. (sunflower) PET1 Sporophytic HaRf1 13 Yue et al., 2010
BT, Boro II; DA, dwarf abortive; HL, Honglian; RM, Rosy Morn; S, USDA; T, Texas; WA, wild abortive.
Three research groups cloned this gene in the same time frame and assigned different names. Brown et al. (2003) named it Rfo, Koizuka et al. (2003) named it orf687, and Desloire et al. (2003) named it Ppr-B. For simplicity, this manuscript refers to it as BnRfo.
§NA, not available. The Fr-mediated restoration of bean is permanent. The presence of Fr causes the permanent elimination of the mitochondrial sterility-associated gene pvs from reproductive tissue (He et al., 1995).