View Full Table | Close Full ViewTable 1.

Expressed sequence markers mapped on chromosome arm 2BS in the Salamouni × Katepwa recombinant inbred population. The source, primer sequences, annealing temperatures, and marker types are indicated.

 
Source Marker PCR† primers Annealing temperature (°C) Marker type‡ (enzyme)
2BS-3 XBM140322 AAGGCTCACCAACAACTCC 50 STS
CTCGGAACAGCAACATTACC
2BS-3 XBF200812 GCATTCCCTCTAACGACTGA 50 STS
TTCTTTGATAACCATCCGTAGG
2BS-3 XBE604773 GAGAGGCGCAAACAAAATAA 50 STS
AACATCCTCATAGCCATCCA
2BS-3 XBE444541§ TGGACCAGTATGAGA 55 STS
TTCTGGAGGATGTTGAGCAC
2BS-3 XBE517745 CTCACCTCCATTGCCTCTAA 50 STS
AGAACCGAAGATTGCTGATG
2BS-3 XBF202540 TGGTTATGGACAAGAGAAGAAAA 50 STS
AGGTAGAAATGAGGCGAGTG
2BS-3 XBF485266 CAGCAAAGAACACGGAAAGT 50 STS
GCAAGCACAGTAAAAGAAGCA
2BS-3 XBE606912 GTCCAGAAGACCTGCAAAGA 54 RFLP (HindIII)
AGACAAGGTGAACTCCCACA
2BS-3 XBF483211 GATACACCAATGACGGAACAA 50 RFLP (EcoRI)
GCCAAGAAGGCTCCAATAAG
Rice and Brachypodium distachyon colinearity XTC317202 AGGCATTTGGTCATTTTGG 50 STS
GAAGGCATACTCAACAGAAATCA
Rice and Brachypodium distachyon colinearity XTCK208937 TCTCATTAATGGCGCTCTCC 52 STS
GAGGTTTCTTCTTGCGCTTG
Rice and Brachypodium distachyon colinearity XTC313504 CTCGTCATGGGGTGACTTTT 50 STS
TGGATCTGCTCGTCAAAGTG
Rice and Brachypodium distachyon colinearity XTC307686 AAGTCGCGTTGATGCAATTA 54 STS
TTGACGTTTGCAACAGTTGAT
Brachypodium distachyon colinearity XTC339813 CGTTCTTTGCACATCACTAA 50 STS
TGGAAATGCCACATCACTGT
PCR, polymerase chain reaction.
STS, sequence-tagged site; RFLP, restriction fragment length polymorphism.
§Marker XBE444541 was initially mapped as an RFLP marker and later converted to a PCR-based STS marker.



View Full Table | Close Full ViewTable 2.

Putative Brachypodium distachyon orthologs of the expressed sequence tag (EST) or tentative consensus (TC) sequences mapped on chromosome 2B in the Salamouni × Katepwa recombinant inbred population based on significant BLASTn and tBLASTx hits to Brachypodium distachyon genomic sequences.

 
BLASTn tBLASTx
Marker TC Gene e value Position (bp) Chr.† Gene e value Position (bp) Chr.
XBM140322 TC312601 NS‡ NS
XBF200812 TC339576 NS Bradi5g214001 2e–81 24,030,676 5
XTC317202 TC317202 Bradi5g01430 8e–94 1399,986 5 Bradi5g014301, 02 2e–95 1400,019 5
XBF483211 TC319144 Bradi5g017401 3e–65 1760,470 5 Bradi5g017401 1e–119 1760,449 5
XCK208937 N/A§ Bradi5g018701 1e–21 1898,167 5 Bradi5g018701 7e–27 1897,704 5
XTC313504 TC313504 No hits 2e–43 1791,258 5 No hits 0 1791,751 5
XBE604773 TC288658 Bradi5g01230 2e–83 1144,639 5 Bradi5g012301 0 1144,638 5
XTC307686 TC307686 No hits 2e–66 4218 5 Bradi5g013401 1e–106 1263,938 5
XBE606912 TC320680 NS NS
XTC339813 TC339813 Bradi5g01940 0 2011,335 5 Bradi5g019401 0 2011,053 5
XBE444541 TC289693 Bradi5g02160 1e–77 2253,564 5 Bradi5g021601 1e–159 2252,432 5
XBE517745 TC323680 Bradi5g023001 4e–62 2408,534 5 Bradi5g023001 1e–142 2408,533 5
XBF202540 TC358868 Bradi5g02400 1e–33 2518,619 5 Bradi5g024001 –04 2e–78 2518,619 5
XBF485266 TC296434 Bradi5g03810 1e–104 4774,323 5 Bradi5g038101 1e–148 4772,425 5
Chr., chromosome.
NS, not significant.
§N/A, not available.



View Full Table | Close Full ViewTable 3.

Putative rice orthologs of the expressed sequence tag (EST) or tentative consensus (TC) sequences mapped on chromosome 2B in the Salamouni × Katepwa recombinant inbred population based on significant BLASTn and tBLASTx hits to rice genomic sequences.

 
BLASTn tBLASTx
Marker TC Gene e value Position (bp) Chr.† Gene e value Position (bp) Chr.
XBM140322 TC312601 NS‡ NS
XBF200812 TC339576 NS LOC_Os02g32770 2.70e–29 19,453,542 2
XTC317202 TC317202 LOC_OS04g02870 4.90e–159 1120,206 4 LOC_OS04g02870 130e–66 1118,608 4
XBF483211 TC319144 LOC_Os10g22560 580e–19 11,621,740 10 LOC_Os07g01070 430e–55 41,699 7
XCK208937 N/A§ LOC_Os04g02510 82e–94 913,265 4 LOC_Os04g02510 15e–34 913,703 4
XTC313504 TC313504 LOC_Os04g27340 600e–21 15,987,294 4 LOC_Os04g27670 14e–119 16,180,747 4
XBE604773 TC288658 LOC_Os04g04254 190e–292 1987,260 4 LOC_Os04g04254 540e–189 1987,261 4
XTC307686 TC307686 No hits 38e–59 30,386 9 LOC_Os04g03990 11e–68 1833,746 4
XBE606912 TC320680 NS NS
XTC339813 TC339813 NS LOC_Os04g02110 340e–124 684,478 4
XBE444541 TC289693 LOC_Os04g01590 320e–282 399,306 4 LOC_Os04g01590 130e–137 399,307 4
XBE517745 TC323680 LOC_Os04g01480 290e–211 325,319 4 LOC_Os04g01480 160e–120 327,479 4
XBF202540 TC358868 LOC_Os04g01230 170e–53 179,571 4 LOC_Os04g01230 450e–50 178,955 4
XBF485266 TC296434 LOC_Os04g14790 200e–203 8304,461 4 LOC_Os04g14790 690e–118 8302,979 4
Chr., chromosome.
NS, not significant.
§N/A, not available.



View Full Table | Close Full ViewTable 4.

Putative proteins of the expressed sequence tag (EST) markers mapped to wheat chromosome arm 2BS based on BLASTx searches.

 
GenBank accession Marker TC† Predicted protein based on NCBI‡ BLASTx e value
BM140322 XBM140322 TC312601 N/A§ NS¶
BF200812 XBF200812 TC339576 cytochrome P450 [Triticum aestivum] 6e–55
N/A XTC317202 TC317202 Os04g0118900 [Oryza sativa (japonica cultivar-group)] 2e–101
BF483211 XBF483211 TC319144 hypothetical protein SORBIDRAFT_01g027250 [Sorghum bicolor] 1e–91
N/A XCK208937 CK208937 hypothetical protein OsI_14623 [Oryza sativa indica Group] 4e–33
N/A XTC313504 TC313504 OSIGBa0106G08.3 [Oryza sativa (indica cultivar-group)] 3e–164
BE604773 XBE604773 TC288658 UDP-glucose:sterol glucosyltransferase [Avena sativa] 0
N/A XTC307686 TC307686 Os04g0129200 [Oryza sativa (japonica cultivar-group)] 7e–96
BE606912 XBE606912 TC320680 N/A NS
N/A XTC339813 TC339813 Vrga1 [Aegilops ventricosa] 3e–153
BE444541 XBE444541 TC289693 hypothetical protein SORBIDRAFT_06g000580 [Sorghum bicolor] 9e–173
BE517745 XBE517745 TC323680 hypothetical protein OsI_14559 [Oryza sativa indica Group] 1e–164
BF202540 XBF202540 TC358868 OSIGBa0123D13.3 [Oryza sativa (indica cultivar-group)] 8e–112
BF485266 XBF485266 TC296434 hypothetical protein OsJ_13895 [Oryza sativa japonica Group] 3e–143
TC, tentative consensus.
NCBI, National Center for Biotechnology Information.
§N/A, not applicable.
NS, not significant.



View Full Table | Close Full ViewTable 5.

Average and range of disease reaction types of parents and recombinant inbred lines of the Salamouni × Katepwa population for the two allelic state combinations for Tsc2 after inoculation with conidia of Pyrenophora tritici-repentis isolate DW5.

 
Genotype Average disease reaction type Reaction type range
Salamouni 1.8 1.5– 2.0
Katepwa 3.7 3.5– 4.0
Tsc2 Tsc2 3.2† 2.0– 3.8
tsc2 tsc2 2.3† 1.3– 3.8
Average disease reaction type of Tsc2 Tsc2 is significantly different from that of the tsc2 tsc2 at the 0.05 level of probability.