View Full Table | Close Full ViewTable 1.

Sample IDs and corresponding adapter and primer sequences. The primer sequences are designed to be complementary to the EcoRI and BfaI adapters and to carry a unique 5′ multiplex identifier (MID) barcode code sequence.

 
Ligation Adapters
EcoRI adapter1 (F) 5′/5BioTEG/-CTCGTAGACTGCGTACC
EcoRI adapter2 (R) CATCTGACGCATGGTTAA-/5Phos/5′
BfaI adapter1 (F) 5′-GACGATGAGTCCTGAG
BfaI adapter2 (R) ACTCAGGACTCAT-/5Phos/5′
Pool-I samples Pool-II‡ Samples MID barcode primers pairs Sequence (5′➔3′)
Eco R Bfa I
Ler-0 (CS20) MID1 ACGAGTGCGTGACTGCGTACCAATTC ACGAGTGCGTGATGAGTCCTGAGTAG
Col-4 (CS933) MID2 ACGCTCGACAGACTGCGTACCAATTC ACGCTCGACAGATGAGTCCTGAGTAG
CS1929 CS1963 MID3 AGACGCACTCGACTGCGTACCAATTC AGACGCACTCGATGAGTCCTGAGTAG
CS1930 CS1964 MID4 AGCACTGTAGGACTGCGTACCAATTC AGCACTGTAGGATGAGTCCTGAGTAG
CS1931 CS1965 MID5 ATCAGACACGGACTGCGTACCAATTC ATCAGACACGGATGAGTCCTGAGTAG
CS1932 CS1966 MID6 ATATCGCGAGGACTGCGTACCAATTC ATATCGCGAGGATGAGTCCTGAGTAG
CS1933 CS1967 MID7 CGTGTCTCTAGACTGCGTACCAATTC CGTGTCTCTAGATGAGTCCTGAGTAG
CS1935 CS1968 MID8 CTCGCGTGTCGACTGCGTACCAATTC CTCGCGTGTCGATGAGTCCTGAGTAG
CS1937 CS1969 MID9 TAGTATCAGCGACTGCGTACCAATTC TAGTATCAGCGATGAGTCCTGAGTAG
CS1940 CS1970 MID10 TCTCTATGCGGACTGCGTACCAATTC TCTCTATGCGGATGAGTCCTGAGTAG
CS1941 CS1971 MID11 TGATACGTCTGACTGCGTACCAATTC TGATACGTCTGATGAGTCCTGAGTAG
CS1942 CS1972 MID12 TACTGAGCTAGACTGCGTACCAATTC TACTGAGCTAGATGAGTCCTGAGTAG
CS1943 CS1973 MID13 CATAGTAGTGGACTGCGTACCAATTC CATAGTAGTGGATGAGTCCTGAGTAG
CS1944 CS1974 MID14 CGAGAGATACGACTGCGTACCAATTC CGAGAGATACGATGAGTCCTGAGTAG
CS1945 CS1975 MID15 ATACGACGTAGACTGCGTACCAATTC ATACGACGTAGATGAGTCCTGAGTAG
CS1946 CS1976 MID16 TCACGTACTAGACTGCGTACCAATTC TCACGTACTAGATGAGTCCTGAGTAG
CS1947 CS1977 MID17 CGTCTAGTACGACTGCGTACCAATTC CGTCTAGTACGATGAGTCCTGAGTAG
CS1948 CS1978 MID18 TCTACGTAGCGACTGCGTACCAATTC TCTACGTAGCGATGAGTCCTGAGTAG
CS1950 CS1980 MID20 ACGACTACAGGACTGCGTACCAATTC ACGACTACAGGATGAGTCCTGAGTAG
CS1951 CS1981 MID21 CGTAGACTAGGACTGCGTACCAATTC CGTAGACTAGGATGAGTCCTGAGTAG
CS1952 CS1982 MID22 TACGAGTATGGACTGCGTACCAATTC TACGAGTATGGATGAGTCCTGAGTAG
CS1953 CS1983 MID23 TACTCTCGTGGACTGCGTACCAATTC TACTCTCGTGGATGAGTCCTGAGTAG
CS1954 CS1985 MID24 TAGAGACGAGGACTGCGTACCAATTC TAGAGACGAGGATGAGTCCTGAGTAG
CS1955 CS1986 MID25 TCGTCGCTCGGACTGCGTACCAATTC TCGTCGCTCGGATGAGTCCTGAGTAG
CS1956 CS1987 MID26 ACATACGCGTGACTGCGTACCAATTC ACATACGCGTGATGAGTCCTGAGTAG
CS1957 CS1988 MID27 ACGCGAGTATGACTGCGTACCAATTC ACGCGAGTATGATGAGTCCTGAGTAG
CS1958 CS1989 MID28 ACTACTATGTGACTGCGTACCAATTC ACTACTATGTGATGAGTCCTGAGTAG
CS1959 CS1990 MID29 ACTGTACAGTGACTGCGTACCAATTC ACTGTACAGTGATGAGTCCTGAGTAG
CS1960 CS1991 MID30 AGACTATACTGACTGCGTACCAATTC AGACTATACTGATGAGTCCTGAGTAG
CS1961 CS1992 MID31 AGCGTCGTCTGACTGCGTACCAATTC AGCGTCGTCTGATGAGTCCTGAGTAG
CS1962 CS1993 MID32 AGTACGCTATGACTGCGTACCAATTC AGTACGCTATGATGAGTCCTGAGTAG
MID barcode sequences are italicized.
Pool-II samples were sequenced with both 454-pyrosequencing and the Illumina 76-bp end sequencing.



View Full Table | Close Full ViewTable 2.

Summary of contigs assembled and single nucleotide polymorphisms (SNPs) identified for each sequencing technology.

 
Contig metrics MAF range SNP type
Method Contigs Bases Avg. contig size (bp) SNPs Unique contigs SNP base coverage 20–29% 30–39% 40–50% A/C A/G A/T C/G C/T G/T
454-pyrosequencing 8573 4,063,602 474 6159 2389 19x 26 34 40 11% 27% 16% 7% 28% 11%
Illumina GAIIe 7179 688,753 48 701 575 49x 19 38 43 9% 30% 11% 9% 30% 11%
MAF, minor allele frequency.



View Full Table | Close Full ViewTable 3.

The number of single nucleotide polymorphisms (SNPs), data points, and average coverage in the mapping analysis at various levels of maximum allowed missing data. Cost per data point estimates are based on in-house sequencing costs.

 
Method Maximum missing data per SNP Number of SNP genotyped Number of data points genotyped Avg. coverage at the genotype Avg. missing data per RIL (Min.–Max. %) Cost per data point
454-pyrosequencing 10% 626 35,083 5.3x 6.5% (0.9–14.7%) $0.343
454-pyrosequencing 20% 1712 89,955 4.5x 12.2% (3.6–24.3%) $0.134 ($0.147)
454-pyrosequencing 30% 2825 139,571 4.0x 17.5% (6.0–33.7%) $0.086
Illumina GAIIe 10% 461 13,993 19.1x 2.2% (0.2–12.2%) $0.076
Illumina GAIIe 20% 504 15,119 18.2x 3.4% (0.9–14.1%) $0.070 (0.113)
Illumina GAIIe 30% 526 15,615 17.9x 4.4% (1.5–15.6%) $0.068
RIL, recombinant inbred line.
Pyrosequencing cost include: 2 runs at $5,800 per 454 sequencing run and genomic reduction cost (61 samples at $6.80 per sample) only. Illumina GAIIe sequencing cost include: 1 lane at $854 per sequencing lane and genomic reduction cost (31 samples at $6.80 per sample) only. Labor costs are not included.
§Maximum missing data (MMD) describes the maximum amount of missing data allowed per SNP in order for that SNP marker to be included in the analysis. At the 20% MMD, the total amount of missing data across all markers was 12.4%.
Cost adjusted for SNPs in complete linkage disequilbrium or dropped from the mapping analysis due to distorted segregation ratios.



View Full Table | Close Full ViewTable 4.

Linkage group summary based on 454-pyrosequencing derived 20% maximum missing data (MMD) dataset.

 
Chromosome 1 (LG1) Chromosome 2 (LG2) Chromosome 3 (LG3) Chromosome 4 (LG4) Chromosome 5 (LG5) Total
Total SNPs 380 (24%) 271 (17%) 300 (19%) 252 (16%) 352 (23%) 1555
Chromosome size (Mb) 30.4 19.7 23.5 18.6 26.9 119.1
Distanced spanned (cM) 174 127 131 102 149 683
Largest interval (cM) 6.0 6.1 7.7 6.1 8.5 N/A
Marker density 1 per cM or Kb 0.46 cM or 174 Kb 0.47 cM or 155 Kb 0.44 cM or 179 Kb 0.40 cM or 182 Kb 0.42 cM or 181 Kb 0.44 cM or 174 Kb
SNP, single nucleotide polymorphism.
NA, not applicable.



View Full Table | Close Full ViewTable 5.

Linkage group summary based Illumina derived 20% maximum missing data (MMD) dataset.

 
Chromosome 1 Chromosome 2 Chromosome 3 Chromosome 4 Chromosome 5 Total
No. of corresponding linkage groups (LGs) 5 (LG6, 8, 10, 13, 14) 3 (LG2, 9,11) 3 (LG3, 7, 12) 2 (LG4, 5) 1 (LG1) 14
Total SNPs 74 (24%) 53 (17%) 57 (18%) 51 (16%) 76 (24%) 311
Chromosome size (Mb) 30.4 19.7 23.5 18.6 26.9 119.1
Distanced spanned (cM) 91 53 73 57 114 388
Largest interval (cM) 6.4 3.9 6.1 6.1 12.4 N/A
Marker density 1 per cM or Kb 1.2 cM or 410 Kb 1.0 cM or 371 Kb 1.28 cM or 412 Kb 1.1 cM or 365 Kb 1.5 cM or 354 Kb 1.2cM or 382 Kb
SNP, single nucleotide polymorphism.
NA, not applicable.