View Full Table | Close Full ViewTable 1.

Polymerase chain reaction primers and probes for dot-blot-SNP analyses.

 
Name Sequence (5′–3′) Region†
Primers for amplification of RPLD1
 FW1 GGTGTGAGGCTTCAAACCTAG PLD1-1
 RV1 AGAGCAAGAGCAAAGACGAGTA PLD1-1
 FW2 CGAGGAGGGAGCCAAATCCA PLD1-2
 RV2 CTCAGGGGTATCAGGGAACC PLD1-2
 FW3 GGGATGTTCTTTACAATTTCG PLD1-3
 RV3 AACAGATGATGAATGCCATGT PLD1-3
Primers for sequencing of RPLD1
 1 FW1 See above PLD1-1
 2 FW1-2 CATTTTCCATCACATCAACT PLD1-1
 3 RV1 See above PLD1-1
 4 RV1-2 AAGAAGAAGGGGAGCAGA PLD1-1
 5 FW2 See above PLD1-2
 6 FW2-2 CTGTGTGTGATGTGTGCTT PLD1-2
 7 RV2 See above PLD1-2
 8 RV2-2 TGAACAATGCTGCCTGAG PLD1-2
 9 FW3 See above PLD1-3
 10 FW3-2 CTGGCAAAGGAGAACAATG PLD1-3
 11 FW3-3 TCTTCTGCTCTCTAAATCTG PLD1-3
 12 RV3 See above PLD1-3
 13 RV3-2 CAACAACGCTAAACAGTAG PLD1-3
Primers for amplification in CAPS and dot-blot-SNP analysis of RPLD1
 PLD1-2503F CACGTGAGCTCATGTCAACAGTTTG PLD1-SNP
 PLD1-2761R GCAGGTAAGCCCTCCCAATATTCG PLD1-SNP
Probes for dot-blot-SNP analysis of RPLD1
 PLD1-NB DIG-CCTCGCTGGTATGAGTC
 PLD1-s108 DIG-CCTCGCTGATATGAGTC
See Fig. 1.